Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,375

1 members and 1,374 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,092
Threads: 248,528
Posts: 2,568,679
Top Poster: JLC (31,651)
Welcome to our newest member, FayeZero
Page 6 of 6 FirstFirst 123456
Results 51 to 53 of 53
  1. #51
    BPnet Veteran GiddyGoat's Avatar
    Join Date
    09-08-2017
    Location
    NY, USA
    Posts
    404
    Thanks
    166
    Thanked 157 Times in 99 Posts
    Images: 28

    Re: What are the strangest bp myths you have heard?

    Quote Originally Posted by Sunnieskys View Post
    i literally just lol'd. This is so damn funny!
    Haha yay, laughter. Sorry for not responding sooner, I got poisoned by a snake tongue. I don't think I'll ever recover....

    And aren't people who do demonstrations supposed to KNOW THEIR STUFF??? Like c'mon XD. I've heard some variations of everything we just said in this thread over the two days of not being here as more people find out I'm getting le snek. *sigh*
    Dewey
    He ain't scare of no things







  2. #52
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    Yeah.... I talked to the lady after the presentation and told her about average BP length and that I had 3 adult females at home that were 5' or less and that it was highly unusual to see one even 6' long much less longer. I think the center just hires or "interns" any bio major with the local university, but just goes to show a science degree doesn't automatically make you an expert in the species you're talking about lol.

    I also told her that she might want to mention about it being illegal to harm or take from the wild any native reptile species in our state (it is a crime) and it being illegal to own any native species here too... Both of which I think are very important and she didn't mention.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  3. #53
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Strangest BP myth? Three words: "Ball python genetics"

    As if ball pythons are some kind of alien species that has genetics that behave completely different from any other organism on this planet
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 6 of 6 FirstFirst 123456

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1