Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,571

1 members and 1,570 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,092
Threads: 248,528
Posts: 2,568,679
Top Poster: JLC (31,651)
Welcome to our newest member, FayeZero
Page 2 of 2 FirstFirst 12
Results 11 to 13 of 13
  1. #11
    Registered User PythonBabes's Avatar
    Join Date
    05-01-2016
    Posts
    405
    Thanks
    71
    Thanked 268 Times in 143 Posts
    Images: 2

    Re: Are morphs more than a colour scheme?

    Quote Originally Posted by AntTheDestroyer View Post
    Is there anything to the statement that piebalds have a tendency to be more difficult feeders than other mutations? I know my two pieds give me more fits than my other snakes, but it is pretty small testing pool.

    Don't think morph has anything to do with feeding tendencies. Except for spider morph the wobble can make it harder for them to eat and I've heard of them 'giving up'.
    1.0- Pastel het Pied- Khaa

  2. #12
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts

    Re: Are morphs more than a colour scheme?

    Quote Originally Posted by AntTheDestroyer View Post
    Is there anything to the statement that piebalds have a tendency to be more difficult feeders than other mutations? I know my two pieds give me more fits than my other snakes, but it is pretty small testing pool.
    My piebald eats like a champ. She is female, all my females eat well. for me the MALES are the difficult eaters.

  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Are morphs more than a colour scheme?

    Quote Originally Posted by OhhWatALoser View Post
    This is news to me, who have you seen report this?
    Quote Originally Posted by cchardwick View Post
    This is the first time I've ever heard of problems with the cypress gene.
    https://www.facebook.com/RobinsonsRo...89786887829603


    Quote Originally Posted by cchardwick View Post
    And my lesser pied has really small eyes but doesn't seem to affect her at all.
    As I said, microphthalmia.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    OhhWatALoser (09-13-2017)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1