Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ


» Today's Birthdays

» Stats

Members: 58,411
Threads: 227,497
Posts: 2,344,611
Top Poster: JLC (31,652)
Welcome to our newest member, Bfisher

» September 2017

S M T W T F S
27 28 29 30 31 1 2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30
Page 1 of 2 12 LastLast
Results 1 to 10 of 13
  1. #1
    Registered User
    Join Date
    09-07-2017
    Posts
    8
    Thanks
    0
    Thanked 1 Time in 1 Post

    Are morphs more than a colour scheme?

    I am wondering if there are any genetic differences between morphs other than basic colouring? I'm thinking size, temperament, eyesight, hearing, striking power/speed, muscular strength, movement differences etc.

  2. #2
    Registered User GiddyGoat's Avatar
    Join Date
    09-08-2017
    Posts
    160
    Thanks
    31
    Thanked 56 Times in 35 Posts
    Images: 4

    Re: Are morphs more than a colour scheme?

    Well I can give you one example: the spider gene. Sometimes if a snake has the spider gene they get a "head wobble". This doesn't really hurt them, and they can be completely happy and healthy, it just makes their movements a little odd, sideways (sometimes), and well, wobbly!

    as for other morphs? I'm not sure, but there is probably some other examples the more experienced hobbyists/breeders on here can give you.
    Dewey the Dank Snek
    He ain't scare of no things







  3. #3
    BPnet Veteran tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois
    Posts
    2,077
    Thanks
    1,238
    Thanked 1,574 Times in 906 Posts
    Images: 32
    other than birthing, reproductive and neurological issues, ball python morphs do not affect anything but their looks.

    the Desert gene female cannot reproduce and she will either not produce viable eggs, or die while passing eggs.

    the Spider gene comes with a neurological affliction that causes their famous wobble.

    some genes, when crossed, produce babies that are inviable or are more prone to life-threatening defects, such as Super Spider (lethal), Caramel Albino (kinking), or Champagne x Spider pairing (lethal).
    Last edited by tttaylorrr; 09-11-2017 at 01:58 PM.
    1.2 Ball Python
    1.0 2014 Albino (Yellow Lemon Lemongrab)
    0.1 2016 Coral Glow/Banana (Spaghetti Marinara Noodle)

    0.1 2017 Super Cinnamon (Coffee Bean) &

    1.0 Corn Snake
    1.0 ?? Hypo ("Corny" Cornelius)


  4. The Following 3 Users Say Thank You to tttaylorrr For This Useful Post:

    craigafrechette (09-11-2017),PokeyTheNinja (09-11-2017),Vipera Berus (09-13-2017)

  5. #4
    Registered User GiddyGoat's Avatar
    Join Date
    09-08-2017
    Posts
    160
    Thanks
    31
    Thanked 56 Times in 35 Posts
    Images: 4

    Re: Are morphs more than a colour scheme?

    Quote Originally Posted by tttaylorrr View Post
    other than birthing, reproductive and neurological issues, ball python morphs do not affect anything but their looks.

    the Desert gene female cannot reproduce and she will either not produce viable eggs, or die while passing eggs.

    the Spider gene comes with a neurological affliction that causes their famous wobble.

    some genes, when crossed, produce babies that are inviable or are more prone to life-threatening defects, such as Super Spider (lethal), Caramel Albino (kinking), or Champagne x Spider pairing (lethal).
    Just as I said, more knowledgable people lol. Besides tttaylorrr knows her stuff, always really helpful :3. Thanks for the info! I learned somethin' new too haha. Never knew that reproductive issues can be the result of certain morph genes
    Last edited by GiddyGoat; 09-11-2017 at 02:01 PM.
    Dewey the Dank Snek
    He ain't scare of no things







  6. #5
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    3,281
    Thanks
    1,537
    Thanked 2,557 Times in 1,638 Posts
    yes, morphs are more than basic coloring. for example, morphs are also a pattern scheme.
    Wicked ones!6292

  7. #6
    Registered User AntTheDestroyer's Avatar
    Join Date
    11-23-2015
    Location
    Denver
    Posts
    333
    Thanks
    17
    Thanked 172 Times in 81 Posts
    Is there anything to the statement that piebalds have a tendency to be more difficult feeders than other mutations? I know my two pieds give me more fits than my other snakes, but it is pretty small testing pool.
    RAD House Reptiles

  8. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    520
    Thanks
    51
    Thanked 299 Times in 150 Posts
    Known issues:

    Spider, Woma, HGW, Champagne, Spotnose, Sable, Cypress (and I will assume Bongo) -- Neuro to some degree or other
    Spider, Woma, Champagne, HGW -- Lethal super form
    Champagne x Sable, Spider x Woma, Champagne x Spider, Champagne x Woma, Champagne x HGW -- Lethal or severe impairment
    Caramel, SuperBlk, SuperCinny, 8Ball -- Kinking
    SuperBlk, SuperCinny, 8Ball -- Duckbill
    SuperLesser/Butter -- Bug-eye
    Pied with BluEL complex -- Microphthalmia
    Desert -- Female breeding issues



    Rumoured/anecdotal/unsubstantiated:

    Pied/het Pied -- Problem feeders
    Spider, Woma -- Extra strong feed response
    Desert -- Delayed development and/or dwarfism
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #8
    BPnet Lifer OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,886
    Thanks
    502
    Thanked 2,539 Times in 1,407 Posts

    Re: Are morphs more than a colour scheme?

    Quote Originally Posted by asplundii View Post
    Known issues:

    Spider, Woma, HGW, Champagne, Spotnose, Sable, Cypress (and I will assume Bongo) -- Neuro to some degree or other
    This is news to me, who have you seen report this?

  10. #9
    Registered User cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    968
    Thanks
    7
    Thanked 516 Times in 300 Posts
    Images: 16
    This is the first time I've ever heard of problems with the cypress gene. I've also heard that all black ball pythons are super aggressive. And my lesser pied has really small eyes but doesn't seem to affect her at all. I have quite a few spider genes, some of them have a head wobble and some of them don't. All of them feed perfectly fine, I just keep them away from deep water LOL. I have a lot of pieds, all of them seem to feed fine.
    Last edited by cchardwick; 09-12-2017 at 01:25 PM.
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Mountain Man Reptiles~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

  11. #10
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    427
    Thanks
    89
    Thanked 168 Times in 118 Posts
    World of Ball Pythons has a picture of a scaleless ball python. Scaleless is found in several other species, too.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1