» Site Navigation
4 members and 2,654 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,083
Threads: 248,525
Posts: 2,568,643
Top Poster: JLC (31,651)
|
-
Is there only one known strain of albinism amongst carpets currently?
Hello all,
I'm looking at picking up a carpet python having been involved primarily in boa care in the past. While I'm not looking to purchase an animal to breed immediately, I would like to know if the only known albino strain falls on darwin carpets right now. The animal I was looking at is 100% het albino......50% Darwin, 37.5% coastal, and 12.5% IJ. So the recessive gene for albinism should be with the darwin half, correct?
In summary, if I buy a male albino someday I want to know if it will be compatible to produce albinos?....boas have different strains (kahl, sharp) that aren't compatible,.......does it work this way in carpets as well?
Thnks, Kevin
-
-
Yes, the Albino morph in captivity originates from the Darwin line and all Albino carpets are derived from that bloodline so will be compatible.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Is there only one known strain of albinism amongst carpets currently?
Thank you! Thats what I needed to know.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|