Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,633

0 members and 3,633 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,095
Threads: 248,535
Posts: 2,568,714
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
Results 1 to 6 of 6
  1. #1
    Registered User
    Join Date
    03-31-2017
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    luecistic with very odd eyes

    This is my first time posting, but I have learned a lot reading everbody's posts. Thank you. I have a 3 yr old normal girl and last March I bought a baby ball online. He was supposed to be a BEL. Breeder said so. He was in shed when I got him and his eyes looked blue. After shedding his eyes are clear looking on top (you can see his eye socket ) and cloudy dark gray below. His pupils are red. I did not contact the breeder about this because I am sure he knew what he had and lied to me. Liars just lie some more.The little guy is doing great, his eyesight seems to be very poor. I can't find any photo that looks like his eyes. Anybody ever see anything like this? I can post a photo later. He is working on his shed right now. Btw I love him even if his eyes are weird

  2. #2
    Registered User
    Join Date
    05-04-2015
    Posts
    90
    Thanks
    0
    Thanked 42 Times in 29 Posts

    Re: luecistic with very odd eyes

    We have several balls where the eyes are 2 different shades and some that have red pupils. A photo would help a ton

    Sent from my LG-H831 using Tapatalk

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If it is a white snake with blue/grey eyes then it is a BluEL. The eyes of BluELs are not solid blue, they have a two-tone effect.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #4
    Registered User
    Join Date
    03-31-2017
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: luecistic with very odd eyes

    Thanks for the info. I've never heard of a BluEl . He is white, or more of an extremely pale pink. He eats well and seems very healthy. I will post photos as soon as he finishes his shed. He tend to take a while. Right now his eyes look silver.

  5. #5
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: luecistic with very odd eyes

    Quote Originally Posted by Eliza View Post
    Thanks for the info. I've never heard of a BluEl . He is white, or more of an extremely pale pink. He eats well and seems very healthy. I will post photos as soon as he finishes his shed. He tend to take a while. Right now his eyes look silver.
    BluEl is just short for blue eyed lucy(luecistic) vs black eyed Lucy. Helps to differentiate between BEL because obviously both blue or black eyes luecistic could be abbreviated to BEL.

    Post a pic either way, I'd love to see what you have and then others will also be able to confirm that you have a normal blue eyed Lucy, there is probably nothing wrong with him.
    Last edited by rufretic; 07-24-2017 at 01:37 PM.

  6. The Following User Says Thank You to rufretic For This Useful Post:

    asplundii (07-25-2017)

  7. #6
    Registered User
    Join Date
    03-31-2017
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: luecistic with very odd eyes

    My little guy had another perfect shed. He is camera shy and I am a little computer challenged, but photos soon. Thanks for info.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1