» Site Navigation
1 members and 3,034 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,031
Threads: 248,490
Posts: 2,568,453
Top Poster: JLC (31,651)
|
-
Exact effect of Congo?
My newest boy that I got is a pastel butter congo.
Also look to my profile for a bit of a better pic, I tried to upload a different one but for some reason it won't let me upload that exact photo. Ill try to get it to work or take a better pic in the morning.
Anyways, I really like the way be looks and it seems pretty unique, to me at least, in color and I was wondering if that was due to the Congo or if it was just the pastel and butter. If so how exactly does the Congo effect him? When I asked the breeder thatvi got him from he simply said it was an enhancing gene and all I've read says the same thing, that it "Cleans up" the morph but I was just wondering how so exactly. When I look at other Congos I find it hard to find any real similarities and if I were to breed him how would I tell what offspring were Congo and which were not?
Any info on it would be awesome and if anyone has experience with the morph inwpuld love to hear it!
Sent from my iPhone using Tapatalk
-
-
-
-
BPnet Veteran
Re: Exact effect of Congo?
No idea but I'll give you a bump, mostly because I want to know.
Sent from my 5056W using Tapatalk
2.3 Ball Python (Thanatos(lesser cinnamon vanilla), Prince(banana vanilla dinker). Lucifer(normal), Snailtail(lesser cinnamon vanilla pastel), Nagini(normal))
1.1 Red Tail Boa (Satin,Tiberius)
0.1* Rottwieler (Lola)
-
-
Re: Exact effect of Congo?
I've been looking into Pastel Butter and comparing them to my boy. It seems as though it makes them look more pale? He is more of a creamy color then the pastel butters I see which seem to be more yellow. He also has less of a blush then I've seen in pastel butters. Perhaps that is what people mean when they say its a clean up morph?
Sent from my iPhone using Tapatalk
-
-
Re: Exact effect of Congo?
Is bongo and congo the same thing? I'm so confused it looks similar but I'm just not sure
Sent from my iPhone using Tapatalk
-
-
Re: Exact effect of Congo?
Originally Posted by BluuWolf
Is bongo and congo the same thing? I'm so confused it looks similar but I'm just not sure
No, Congo and Bongo are not the same thing. How much did your snake cost you? Was it in the $1500-$3000 range? If not, then it is not a Bongo as Bongo is a relatively new gene and still fetches higher dollar.
Congo is a gene that originated with Vin Russo. I suggest checking out his website for the story
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Exact effect of Congo?
Originally Posted by asplundii
No, Congo and Bongo are not the same thing. How much did your snake cost you? Was it in the $1500-$3000 range? If not, then it is not a Bongo as Bongo is a relatively new gene and still fetches higher dollar.
Congo is a gene that originated with Vin Russo. I suggest checking out his website for the story
Ahh alright thanks XD I hadn't looked into the price range just some pictures after a friend showed it to me thinking it was a congo. I've looked at his website and read up on it but it doesn't talk really on the exact affects, just about how its a clean up gene and it pairs good with pastels
Sent from my iPhone using Tapatalk
Last edited by BluuWolf; 07-24-2017 at 08:42 AM.
-
-
Honestly, it can take a few shed cycles to identify which babies have Congo and which do not. On its own, Congo has a slightly lighter green look to the body color and slightly more crisp black. In combinations, you have to look for subtle changes. Congo generally lightens up a combination and removes black speckling in the body color. I have only worked a little bit with Congo and found the comparison in the Fire gene one of the more observable. Please look at my thread on the Congo Fire. It has a lot of good comparison pictures.
https://ball-pythons.net/forums/show...119-Congo-Fire
When you hatch out babies, you will have to wait for them to shed and compare how they each look in order to have a good chance to see which, if any, babies got the Congo gene. I am waiting for my babies from a Pastel GHI to the female Congo Fire that I kept in the above thread. I intend to post pictures of them when I get some time (I will post pictures on our Facebook page, but it may take some time to write up another thread on the new babies).
-
-
Re: Exact effect of Congo?
Originally Posted by Slowcountry Balls
Honestly, it can take a few shed cycles to identify which babies have Congo and which do not. On its own, Congo has a slightly lighter green look to the body color and slightly more crisp black. In combinations, you have to look for subtle changes. Congo generally lightens up a combination and removes black speckling in the body color. I have only worked a little bit with Congo and found the comparison in the Fire gene one of the more observable. Please look at my thread on the Congo Fire. It has a lot of good comparison pictures.
https://ball-pythons.net/forums/show...119-Congo-Fire
When you hatch out babies, you will have to wait for them to shed and compare how they each look in order to have a good chance to see which, if any, babies got the Congo gene. I am waiting for my babies from a Pastel GHI to the female Congo Fire that I kept in the above thread. I intend to post pictures of them when I get some time (I will post pictures on our Facebook page, but it may take some time to write up another thread on the new babies).
Thank you so much! This was really helpful! I had thought his pattern looked a lot cleaner and he was a more lighter, cream color with less blushing then pastel butters I have seen but I could just never find enough info on the morph to say if that was the congo showing or not. On your fire congo her head was a lot lighter then the fire and my pastel butter congos head seems lighter then pastel butters, is that semi consistent to other congos you think? Anyways I will defenantly keep a look out for the pics of your babies!
Sent from my iPhone using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|