Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 371

13 members and 358 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 64,554
Threads: 239,032
Posts: 2,483,338
Top Poster: JLC (31,652)
Welcome to our newest member, ajiwarpani

View Poll Results: What is your favorite albino?

Voters
92. You may not vote on this poll
  • Albino

    16 17.39%
  • Candy

    8 8.70%
  • Candino

    14 15.22%
  • Lavender

    46 50.00%
  • I don't like albinos

    8 8.70%
Page 1 of 5 12345 LastLast
Results 1 to 10 of 45

Hybrid View

  1. #1
    BPnet Veteran JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,025
    Thanks
    2,000
    Thanked 2,817 Times in 1,556 Posts
    Images: 76

    What is your favorite albino?

    What is your favorite albino?

  2. #2
    Registered User VIP CONSTRICTORS's Avatar
    Join Date
    05-01-2017
    Posts
    56
    Thanks
    5
    Thanked 15 Times in 14 Posts

    Re: What is your favorite albino?

    T negative blood python

  3. The Following User Says Thank You to VIP CONSTRICTORS For This Useful Post:

    JodanOrNoDan (06-21-2017)

  4. #3
    BPnet Veteran JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,025
    Thanks
    2,000
    Thanked 2,817 Times in 1,556 Posts
    Images: 76

    Re: What is your favorite albino?

    Quote Originally Posted by VIP CONSTRICTORS View Post
    T negative blood python
    LOL. Mine happens to be an Albino burm, but I am after red eyed balls on this one.

  5. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    763
    Thanks
    75
    Thanked 523 Times in 287 Posts

    Re: What is your favorite albino?

    I am an 'Ino fan because it allows me to go both directions is I am so inclined

    Quote Originally Posted by JodanOrNoDan View Post
    but I am after red eyed balls on this one.
    If the look of the eyes is important to you then one thing to note -- the eyes on 'Inos and pure Candy/Toffee are not bright red like the eyes of Albinos. On the prior they are a deeper garnet and on the latter they shift to an almost copper/bronze
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Albert Clark (05-20-2018),JodanOrNoDan (06-22-2017)

  7. #5
    BPnet Veteran JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,025
    Thanks
    2,000
    Thanked 2,817 Times in 1,556 Posts
    Images: 76

    Re: What is your favorite albino?

    Quote Originally Posted by asplundii View Post
    I am an 'Ino fan because it allows me to go both directions is I am so inclined



    If the look of the eyes is important to you then one thing to note -- the eyes on 'Inos and pure Candy/Toffee are not bright red like the eyes of Albinos. On the prior they are a deeper garnet and on the latter they shift to an almost copper/bronze
    Yeah. My lavenders have deep ruby red eyes, where the "normal" albinos are reddish pink. The candy I only know from pictures and babies I have seen. Hopefully I will be owning something in it with candy shortly if one of the board member's eggs ever hatch. lol. I really dislike the names candy and toffee. Very poor choices for a snake morph name in my opinion. Makes it sound like a kid's toy.

  8. The Following User Says Thank You to JodanOrNoDan For This Useful Post:

    Albert Clark (05-20-2018)

  9. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    763
    Thanks
    75
    Thanked 523 Times in 287 Posts

    Re: What is your favorite albino?

    Quote Originally Posted by JodanOrNoDan View Post
    I really dislike the names candy and toffee... Makes it sound like a kid's toy.
    With Toffee I at least understand the naming because the adults are, legitimately, toffee-coloured.


    Quote Originally Posted by JodanOrNoDan View Post
    Very poor choices for a snake morph name in my opinion.
    No worse than dozens of others out there LOL


    Quote Originally Posted by JodanOrNoDan View Post
    Hopefully I will be owning something in it with candy shortly if one of the board member's eggs ever hatch. lol.
    Well, if they do not end up with what you are looking for I might be able to help you out as well, depending on what hatches out of my AlbinoWoma x Candino clutch. If I hit the Woma'Ino then I will be making two breeder males carrying the Candy gene available
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #7
    Telling it like it is! Deborah's Avatar
    Join Date
    09-28-2006
    Posts
    23,837
    Thanks
    5,864
    Thanked 18,920 Times in 8,844 Posts
    Blog Entries
    1
    Images: 6
    On their own I really don't care about Albino BP, I only care about two combos. (Albino Black Pastel & Albino Pied)

    My main issue with albinos BP and most combos is the yellow bleeding into the white.

    Now in other animals I am a big fan of High Orange or extreme Red Albino Hognose.
    Last edited by Deborah; 06-21-2017 at 02:36 PM.

  11. The Following 2 Users Say Thank You to Deborah For This Useful Post:

    JodanOrNoDan (06-21-2017),nme0w (03-01-2018)

  12. #8
    BPnet Lifer Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    5,242
    Thanks
    2,035
    Thanked 3,170 Times in 2,033 Posts

    What is your favorite albino?

    Easy .

    My Albino Imperial Peublan Hybrid ( Milk X King ) !!



    Closely followed by Albino Royals , then Albino Retics


    Sent from my iPad using Tapatalk
    Last edited by Zincubus; 06-21-2017 at 01:17 PM.




  13. The Following 13 Users Say Thank You to Zincubus For This Useful Post:

    + Show/Hide list of the thanked

    Albert Clark (05-20-2018),BeelzeBall. (06-21-2017),C.Marie (03-06-2018),cattleya0507 (03-30-2019),cletus (02-10-2019),Luvyna (02-09-2019),Maddlesrain (05-08-2018),Marzipan (06-22-2017),richardhind1972 (03-02-2018),RoyalLover (02-16-2019),silverdreams (06-22-2017),Sonny1318 (02-09-2019),Spechal (05-11-2018)

  14. #9
    Registered User
    Join Date
    06-05-2017
    Posts
    39
    Thanks
    39
    Thanked 9 Times in 6 Posts

    Re: What is your favorite albino?

    Quote Originally Posted by Zincubus View Post
    Easy .

    My Albino Imperial Peublan Hybrid ( Milk X King ) !!



    Closely followed by Albino Royals , then Albino Retics


    Sent from my iPad using Tapatalk
    Holy mother of God that's beautiful...

  15. The Following User Says Thank You to jonarnold85 For This Useful Post:

    Zincubus (06-21-2017)

  16. #10
    Registered User BeelzeBall.'s Avatar
    Join Date
    05-03-2016
    Location
    Riverside.CA
    Posts
    345
    Thanks
    431
    Thanked 135 Times in 114 Posts
    very nice zincubus

  17. The Following User Says Thank You to BeelzeBall. For This Useful Post:

    Zincubus (06-21-2017)

Page 1 of 5 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1