» Site Navigation
4 members and 2,946 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,533
Posts: 2,568,697
Top Poster: JLC (31,651)
|
-
I believe, and sincerely hope, you are wrong.
Super cinnamon/black pastel morphs do end up causing an all black snake, however black is also the normal ball python background color. If you pay attention to super C/BP ball pythons that also have another morph you will notice that often the background color of those snakes affects the black of the super C/BP.
There may be a darker lean to it, but I would highly doubt a super C/BP sunset would be all black, especially considering how many super C/BP with some other morph there are and with how most look very different from the standard super C/BP
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
The Following User Says Thank You to Oxylepy For This Useful Post:
-
Registered User
Scaleless Banana Pied, and Scaleless Banana Clowns. and/or any Scaleless Banana morphs
1.0 Banana Hypo
1.0 Pastave Enchi
1.0 Pastel +
0.1 Normal Het. Hypo
0.1 Killer Blast
0.1 Killer Calibee
0.1 Queenbee
-
-
-
The Following User Says Thank You to se7en For This Useful Post:
-
Re: Morphs you most want to see.
Originally Posted by Oxylepy
I believe, and sincerely hope, you are wrong.
Super cinnamon/black pastel morphs do end up causing an all black snake, however black is also the normal ball python background color. If you pay attention to super C/BP ball pythons that also have another morph you will notice that often the background color of those snakes affects the black of the super C/BP.
There may be a darker lean to it, but I would highly doubt a super C/BP sunset would be all black, especially considering how many super C/BP with some other morph there are and with how most look very different from the standard super C/BP
I truly hope you are right. And I suppose only time will tell
Laziness is nothing more than the habit of resting before you get tired.
-
The Following User Says Thank You to StillBP For This Useful Post:
-
DesertGhost Enchi Fire Leopard (Super)OrangeDream Woma Yellowbelly
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Morphs you most want to see.
Originally Posted by Oxylepy
I believe, and sincerely hope, you are wrong.
Super cinnamon/black pastel morphs do end up causing an all black snake, however black is also the normal ball python background color. If you pay attention to super C/BP ball pythons that also have another morph you will notice that often the background color of those snakes affects the black of the super C/BP.
There may be a darker lean to it, but I would highly doubt a super C/BP sunset would be all black, especially considering how many super C/BP with some other morph there are and with how most look very different from the standard super C/BP
I agree with this for the most part but it doesn't always work this way. I know the banana super cinnamons are far from all purple. Hopefully you're right though.
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to kxr For This Useful Post:
-
-
-
Re: Morphs you most want to see.
Originally Posted by kxr
I agree with this for the most part but it doesn't always work this way. I know the banana super cinnamons are far from all purple. Hopefully you're right though.
Sent from my iPhone using Tapatalk
I can make it easy to see I am working with sunset and will be pairing my het male to a beautiful black pastel this year. So as far as super black pastel sunset goes it's just a matter of time. Granted it will still be years and I had not planned for the super but...
Last edited by StillBP; 05-15-2017 at 10:31 AM.
Laziness is nothing more than the habit of resting before you get tired.
-
The Following User Says Thank You to StillBP For This Useful Post:
-
Coral Glow Leopard Clown Pied
-
-
Super Clown Super Saiyan Level 7
Super Pied Lambo
Monarch Killer Leopard Clown
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|