Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ


» Today's Birthdays

» Stats

Members: 57,355
Threads: 225,463
Posts: 2,325,047
Top Poster: JLC (31,654)
Welcome to our newest member, brianmheinz

» June 2017

S M T W T F S
28 29 30 31 1 2 3
4 5 6 7 8 9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 1
Results 1 to 8 of 8
  1. #1
    BPnet Lifer OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,801
    Thanks
    480
    Thanked 2,440 Times in 1,368 Posts

    Updated morph issues list

    Not much to add from a few years ago. If any thing is added it will be here: http://www.owalreptiles.com/issues.php

    Morph Issue
    Spider Wobble
    Woma Wobble
    Hidden Gene Woma Wobble
    Champagne Wobble
    Super Sable Wobble
    Powerball Wobble
    Black Head x Spider Masks the Spider's wobble
    Sable x Spider Difficult to hatch, severe wobble
    Champagne x Hidden Gene Woma Severe wobble
    Champagne x Spider Lethal
    Pearl Normally Lethal
    Super Champagne Lethal
    Super Spider Lethal
    Desert Female fertility issues
    Caramel Albino Kinking and female sub-fertility
    Super Cinnamon/Super Black Pastel Duckbill & rare kinking
    Super Lesser Platinum/Super Butter Bug eyes
    Lesser Platinum x Piedbald Small Eyes
    Banana/Coral Glow Males produce weird sex ratios

    anyone have anything to add or look into?


  2. The Following 5 Users Say Thank You to OhhWatALoser For This Useful Post:

    craigafrechette (04-21-2017),J880011 (04-21-2017),JodanOrNoDan (04-10-2017),MissterDog (04-21-2017),rufretic (04-10-2017)

  3. #2
    Registered User JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    1,941
    Thanks
    1,013
    Thanked 1,429 Times in 899 Posts
    Images: 32
    Thank you sir, you are definitely the go to guy for this type of stuff.

  4. #3
    Registered User rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    178
    Thanks
    78
    Thanked 81 Times in 63 Posts
    Images: 9
    I believe hidden gene woma creates a lethal super.

  5. #4
    BPnet Lifer OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,801
    Thanks
    480
    Thanked 2,440 Times in 1,368 Posts

    Re: Updated morph issues list

    Quote Originally Posted by rufretic View Post
    I believe hidden gene woma creates a lethal super.
    yup, thats the pearl


  6. The Following User Says Thank You to OhhWatALoser For This Useful Post:

    rufretic (04-12-2017)

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    476
    Thanks
    42
    Thanked 266 Times in 128 Posts

    Re: Updated morph issues list

    Quote Originally Posted by OhhWatALoser View Post
    [td]Lesser Platinum x Piedbald[/td]
    [td]Small Eyes[/td]

    It seems that most of the hetBluELs have a likelihood of microphthalmia that is inversely proportional to the strength of the hetBluEL gene (e.g., common in LesserPied, occasional in MojavePied, infrequent in SpecialPied). And so far every BluELPied I have seen has (not surprisingly) had microphthalmia.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #6
    BPnet Lifer OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,801
    Thanks
    480
    Thanked 2,440 Times in 1,368 Posts

    Re: Updated morph issues list

    Quote Originally Posted by asplundii View Post
    It seems that most of the hetBluELs have a likelihood of microphthalmia that is inversely proportional to the strength of the hetBluEL gene (e.g., common in LesserPied, occasional in MojavePied, infrequent in SpecialPied). And so far every BluELPied I have seen has (not surprisingly) had microphthalmia.
    Never really thought about it but, when I think back that's held true. Very interesting observation. I guess my next question would be does this also come into play with super lessers, as sometimes they have bug eyes or is it a different condition as the eye appear to be bigger and not smaller.


  9. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    476
    Thanks
    42
    Thanked 266 Times in 128 Posts

    Re: Updated morph issues list

    Quote Originally Posted by OhhWatALoser View Post
    I guess my next question would be does this also come into play with super lessers, as sometimes they have bug eyes or is it a different condition as the eye appear to be bigger and not smaller.
    I am sure there is an interaction happening in both mutations that revolves around the eye development pathway. That said, I do not know where exactly in that pathway the two mutations are interacting
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #8
    BPnet Veteran kxr's Avatar
    Join Date
    12-01-2014
    Location
    Ontario, Canada
    Posts
    734
    Thanks
    403
    Thanked 456 Times in 327 Posts

    Re: Updated morph issues list

    I can contribute Scroll down a bit on this page and look up what it says about super cypress. (It's with the picture of the super and the super Mojave Combo) https://m.facebook.com/RobinsonsRoyalPythons/


    Sent from my iPhone using Tapatalk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1