» Site Navigation
2 members and 3,197 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,535
Posts: 2,568,703
Top Poster: JLC (31,651)
|
-
Natural Morph Creation
I have been doing some 'light' reading on the known instances of parthenogenesis in snakes, mainly pythons and though a lot of the information goes over my head, it got me to thinking on the various morphs. If I am remembering correctly morphs like mota, leopard, and acid all were isolated from wild caught "normal" snakes that looked different - and it turns out the traits are genetic and hence became morphs.
It made me wonder if some wild populations that exhibited atypical patterns maybe did so because at one point some females with the atypical genes created a line through parthenogenesis...then generational interbred and created a variant within that local population. I know that many variants to color in other species are due to environmental pressures or genetic isolation, but it seemed like an interesting theory. Also interesting that the ball python created unique young while the burms made clones.
Anyway - thought it was interesting, just got my mind wondering what environmental pressures gifted us with all the dominant basic morphs
Here is a link to one paper that mentioned ball pythons specifically. http://www.snakegenomics.org/CastoeL...JLS%202014.pdf
Last edited by Crowfingers; 04-04-2017 at 03:10 PM.
No cage is too large - nature is the best template - a snoot can't be booped too much
-
The Following 2 Users Say Thank You to Crowfingers For This Useful Post:
JodanOrNoDan (04-04-2017),paulh (04-05-2017)
-
Sounds really interesting. I'm going to read through it tonight. Reading this type of stuff I actually have to focus.
-
The Following User Says Thank You to JodanOrNoDan For This Useful Post:
-
Re: Natural Morph Creation
Yeah, I was just looking through the libraries data base while waiting for my car to get done at the shop...might need a nap when I get home
No cage is too large - nature is the best template - a snoot can't be booped too much
-
-
Why not? I'd think that between general copying errors, chromosomal crossover, environmental factors such as radiation, and viral/bacterial changes there isn't a reason why some changes wouldn't occur due to parthenogenesis in isolated females.
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
I think you are overcomplicating it. These mutations likely arose spontaneously and, because they are mostly cryptic, especially with the ones you cite, there was not a significant selective disadvantage to them so they were able to perpetuate at some low level in the population.
Parthenogenesis is not going to act as a special catalyst for spreading morph genes in a population (especially not for something like Mota). Plus, natural parthenogenesis happens pretty frequently in the wild and we do not see morphs spreading from those occurrences.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 4 Users Say Thank You to asplundii For This Useful Post:
Ciryluk3g (04-08-2017),Crowfingers (04-04-2017),janeothejungle (04-09-2017),paulh (04-05-2017)
-
No, it definitely could be a factor. The problem is that there are so many ways morphs can form (spontaneous is a decent way to sum it up) that it is definitely possible it has happened, although it wouldn't have been some kind of critical component in the spreading of morphs.
Now, are pythons ZW, or XY?
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
Re: Natural Morph Creation
Pythons are ZW from what I read
No cage is too large - nature is the best template - a snoot can't be booped too much
-
The Following User Says Thank You to Crowfingers For This Useful Post:
-
Parthenogenesis is unlikely to create any new morph. It will result in heterozygous loci largely becoming homozygous, therefore if the mother has a rare mutation that results in a new phenotype, that could become expressed in the the offspring. Whether that then becomes that catalyst for a new morph to become evident in the population is very unlikely.
You can read more papers on snake parthenogenesis at my website - www.booth-lab.org then go to the publications section.
Are pythons XY or ZW.... i'll report on that in a few weeks. We a have a new paper in review.
Warren
-
The Following User Says Thank You to Warren_Booth For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|