Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,303

1 members and 2,302 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,071
Threads: 248,522
Posts: 2,568,603
Top Poster: JLC (31,651)
Welcome to our newest member, jpriebe2
Page 2 of 2 FirstFirst 12
Results 11 to 18 of 18
  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    The PurplePassionPied will be a solid white snake and with have microphthalmia

    http://www.reptileradio.net/showthre...908#post934908
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Slowcountry Balls (03-18-2017),Trisnake (03-17-2017)

  3. #12
    Registered User
    Join Date
    03-28-2016
    Posts
    301
    Thanks
    474
    Thanked 208 Times in 104 Posts
    edit ignore me am being a spoon!
    Last edited by embrit345; 03-17-2017 at 09:01 AM.

  4. #13
    BPnet Senior Member Lizardlicks's Avatar
    Join Date
    12-08-2014
    Location
    Spokane, WA
    Posts
    1,524
    Thanks
    814
    Thanked 1,149 Times in 657 Posts

    Re: purple passion pied?

    Quote Originally Posted by embrit345 View Post
    Cancel my last statement!!!!

    So my hubby and I "adopted" some young American air men and woman who are stationed at one of our local bases here i the UK. 13 of them to be exact lol

    They just all messaged me a happy happy early mothers day and have chipped in together and bought me a pied male!!!!!!

    I am gonna call him USAF heheh xx

    Pics will follow once I figure out how to get tapatalk on my mobile again so I can do them from there xx
    Awww that's so awesome! Congrats!

  5. The Following User Says Thank You to Lizardlicks For This Useful Post:

    embrit345 (03-17-2017)

  6. #14
    BPnet Veteran Trisnake's Avatar
    Join Date
    08-20-2016
    Location
    North of Houston, TX
    Posts
    551
    Thanks
    378
    Thanked 290 Times in 209 Posts
    Images: 1

    Re: purple passion pied?

    Quote Originally Posted by asplundii View Post
    The PurplePassionPied will be a solid white snake and with have microphthalmia

    http://www.reptileradio.net/showthre...908#post934908
    Welp.... a bit of a let down but exciting stuff to discover I guess. Genetics will forever fascinate me.

    I do wish the links to the images of the passion pied and passion het pied were still valid.

  7. The Following User Says Thank You to Trisnake For This Useful Post:

    embrit345 (03-20-2017)

  8. #15
    BPnet Veteran Slowcountry Balls's Avatar
    Join Date
    02-06-2011
    Location
    Bluffton, SC
    Posts
    825
    Thanks
    456
    Thanked 625 Times in 398 Posts
    Images: 806

    Re: purple passion pied?

    Quote Originally Posted by Lizardlicks View Post
    So for a while I was hitting a recursive google image search loop where it points me to pintrest and pintrest lists the source as google image search The only pic that looked like it might be pied was this one, but reverse image search showed that was actually a super cinny with a ringer produced by Markus Jayne



    No entry on WoBP either, and I don't know of anyone on specific who's working toward that combo, so my best guess is you can't find it because no one has produced it, or if they have they haven't said anything about it.
    I think that might be one of Brandon Osborne's Urban Camo animals (https://ball-pythons.net/forums/show...EADY-TO-BREED!)

    Quote Originally Posted by asplundii View Post
    The PurplePassionPied will be a solid white snake and with have microphthalmia

    http://www.reptileradio.net/showthre...908#post934908
    You beat me to it Travis! When I saw the title of this thread I thought of the Mystic Potion Pied that Adam and Lisa from the Herp Vault produced.

  9. The Following 2 Users Say Thank You to Slowcountry Balls For This Useful Post:

    asplundii (03-20-2017),embrit345 (03-20-2017)

  10. #16
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,049 Times in 622 Posts
    Images: 16
    I work mostly with pied combos and some combos are pretty much 'dead ends' as far as changing the color of the snake. Once you get to an all white snake you can add just about anything else and it won't change much. However, once you get to that point they are genetic powerhouses and will pop out all kinds of combos from one snake. There are some combos I'm avoiding like Bamboo pieds, not much pattern left there. And anything that changes the pattern such as Leopard Pied, you really can't tell if it's Leopard since the pied gene jumbles the patterns anyway in most cases. Right now I'm working with Pied + albino, pinstripe, fire, pastel, coral glow, and spider. I'd love to jump into the black pastel and go for the super black pastel pied (Panda Pied). I still don't have Mojave pied, I may pick one of those up next... I also have my own pet project, I'm trying to make a Super Jungle Woma pied (Puzzleback Pied) from scratch, I'm hoping to get there first for the 'World's First'! Still have a few years to go!

    Super Jungle Womas:
    Last edited by cchardwick; 03-18-2017 at 10:55 AM.


  11. The Following 3 Users Say Thank You to cchardwick For This Useful Post:

    embrit345 (03-20-2017),JodanOrNoDan (03-18-2017),Lizardlicks (03-18-2017)

  12. #17
    BPnet Veteran Dezoruba's Avatar
    Join Date
    06-11-2016
    Posts
    374
    Thanks
    1,095
    Thanked 174 Times in 122 Posts

    Re: purple passion pied?

    Quote Originally Posted by cchardwick View Post
    I work mostly with pied combos and some combos are pretty much 'dead ends' as far as changing the color of the snake. Once you get to an all white snake you can add just about anything else and it won't change much. However, once you get to that point they are genetic powerhouses and will pop out all kinds of combos from one snake. There are some combos I'm avoiding like Bamboo pieds, not much pattern left there. And anything that changes the pattern such as Leopard Pied, you really can't tell if it's Leopard since the pied gene jumbles the patterns anyway in most cases. Right now I'm working with Pied + albino, pinstripe, fire, pastel, coral glow, and spider. I'd love to jump into the black pastel and go for the super black pastel pied (Panda Pied). I still don't have Mojave pied, I may pick one of those up next... I also have my own pet project, I'm trying to make a Super Jungle Woma pied (Puzzleback Pied) from scratch, I'm hoping to get there first for the 'World's First'! Still have a few years to go!

    Super Jungle Womas:
    I just jumped into panda pieds with my purchase of a black pastel het pied and pied pair. I'm both super scared and super excited for it.

    Sent from my SAMSUNG-SM-N920A using Tapatalk

  13. The Following User Says Thank You to Dezoruba For This Useful Post:

    embrit345 (03-20-2017)

  14. #18
    BPnet Veteran
    Join Date
    08-29-2006
    Posts
    311
    Thanks
    96
    Thanked 191 Times in 108 Posts
    I may be after a panda- male black pewter het pied, female black pastel champagne POS het pied. Also have my killer pied POS Leopard female for good measure

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1