Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ


» Today's Birthdays

» Stats

Members: 57,312
Threads: 225,373
Posts: 2,324,335
Top Poster: JLC (31,654)
Welcome to our newest member, Nickfrath

» June 2017

S M T W T F S
28 29 30 31 1 2 3
4 5 6 7 8 9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 1
Results 1 to 5 of 5

Thread: Recessive genes

  1. #1
    Registered User
    Join Date
    06-16-2016
    Location
    shingle springs ca
    Posts
    188
    Thanks
    30
    Thanked 17 Times in 14 Posts

    Recessive genes

    Iam just double checking...
    So if I breed a recessive gene to a normal all the babies will be 100% het for that gene, correct??

    Sent from my Pixel XL using Tapatalk

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    475
    Thanks
    42
    Thanked 266 Times in 128 Posts
    That is correct
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Dezoruba (01-11-2017),robert7107 (01-11-2017)

  4. #3
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    11,082
    Thanks
    5,493
    Thanked 5,822 Times in 3,752 Posts
    Images: 2
    Yes and no....... If its a visual recessive they will all be 100% BUT if you are breeding a Het recessive they will all be 50%.

  5. The Following User Says Thank You to PitOnTheProwl For This Useful Post:

    PghBall (01-11-2017)

  6. #4
    Registered User
    Join Date
    06-16-2016
    Location
    shingle springs ca
    Posts
    188
    Thanks
    30
    Thanked 17 Times in 14 Posts

    Re: Recessive genes

    Quote Originally Posted by PitOnTheProwl View Post
    Yes and no....... If its a visual recessive they will all be 100% BUT if you are breeding a Het recessive they will all be 50%.
    Looking at a albino black pastel butter to..
    Mojave
    Mojave pastel
    Mojave spider
    Spider het 100% albino

    Sent from my Pixel XL using Tapatalk

  7. #5
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    11,082
    Thanks
    5,493
    Thanked 5,822 Times in 3,752 Posts
    Images: 2
    An Albino Black Bee would be nice.
    BUT an Albino Butter Bee would be SMOKING
    Last edited by PitOnTheProwl; 01-11-2017 at 04:39 PM.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1