Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 333

15 members and 318 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

Kam (37)

» Stats

Members: 60,782
Threads: 232,551
Posts: 2,404,450
Top Poster: JLC (31,652)
Welcome to our newest member, LisaMercurio
Results 1 to 5 of 5

Thread: Recessive genes

  1. #1
    Registered User robert7107's Avatar
    Join Date
    06-16-2016
    Location
    shingle springs ca
    Posts
    486
    Thanks
    86
    Thanked 115 Times in 75 Posts

    Recessive genes

    Iam just double checking...
    So if I breed a recessive gene to a normal all the babies will be 100% het for that gene, correct??

    Sent from my Pixel XL using Tapatalk

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    650
    Thanks
    63
    Thanked 414 Times in 223 Posts
    That is correct
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Dezoruba (01-11-2017),robert7107 (01-11-2017)

  4. #3
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    11,572
    Thanks
    5,870
    Thanked 6,398 Times in 4,015 Posts
    Images: 3
    Yes and no....... If its a visual recessive they will all be 100% BUT if you are breeding a Het recessive they will all be 50%.

  5. The Following User Says Thank You to PitOnTheProwl For This Useful Post:

    PghBall (01-11-2017)

  6. #4
    Registered User robert7107's Avatar
    Join Date
    06-16-2016
    Location
    shingle springs ca
    Posts
    486
    Thanks
    86
    Thanked 115 Times in 75 Posts

    Re: Recessive genes

    Quote Originally Posted by PitOnTheProwl View Post
    Yes and no....... If its a visual recessive they will all be 100% BUT if you are breeding a Het recessive they will all be 50%.
    Looking at a albino black pastel butter to..
    Mojave
    Mojave pastel
    Mojave spider
    Spider het 100% albino

    Sent from my Pixel XL using Tapatalk

  7. #5
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    11,572
    Thanks
    5,870
    Thanked 6,398 Times in 4,015 Posts
    Images: 3
    An Albino Black Bee would be nice.
    BUT an Albino Butter Bee would be SMOKING
    Last edited by PitOnTheProwl; 01-11-2017 at 04:39 PM.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1