Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 324

8 members and 316 guests
Most users ever online was 3,642, 05-08-2016 at 09:50 AM.


» Today's Birthdays

minatrea (49)
venefica (19)

» Stats

Members: 63,383
Threads: 237,156
Posts: 2,462,605
Top Poster: JLC (31,652)
Welcome to our newest member, Zrycc
Page 2 of 2 FirstFirst 12
Results 11 to 18 of 18

Thread: Rubber boa

  1. #11
    BPnet Senior Member Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    5,101
    Thanks
    1,996
    Thanked 3,017 Times in 1,948 Posts

    Re: Rubber boa

    Quote Originally Posted by asplundii View Post
    Ever since PhotoBucket went to Hades in a hand basket I kind of gave up on finding a photohosting site. If you have Instagram you can see some pics of them there... @actcattgg
    Try using the free forum app TapaTalk .

    Apart from all its other benefits it has a simple and free photo upload option


    Sent from my iPhone using Tapatalk Pro




  2. #12
    BPnet Veteran KevinK's Avatar
    Join Date
    09-16-2011
    Location
    The Land of Beer and Cheese
    Posts
    844
    Thanks
    623
    Thanked 759 Times in 380 Posts

    Re: Rubber boa

    I have no idea why, but I used to see them in Reptiles Magazine when I was a kid ALL the time. I remember reading plenty of articles about them and then their popularity in the pet trade kind of died out when Ball Pythons took over (I assume this is what happened). I do know they can live quite a while however.

  3. The Following User Says Thank You to KevinK For This Useful Post:

    Bogertophis (12-04-2018)

  4. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    708
    Thanks
    70
    Thanked 476 Times in 260 Posts

    Re: Rubber boa

    Quote Originally Posted by Zincubus View Post
    Try using the free forum app TapaTalk .

    Apart from all its other benefits it has a simple and free photo upload option
    I am old and curmudgeonly, I do everything on a desk/lap top LOL
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (01-07-2019)

  6. #14
    BPnet Senior Member Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    5,101
    Thanks
    1,996
    Thanked 3,017 Times in 1,948 Posts

    Re: Rubber boa

    Quote Originally Posted by asplundii View Post
    I am old and curmudgeonly, I do everything on a desk/lap top LOL
    I think Tapatalk works on laptops etc .. think of it like a program like CDex or something


    Sent from my iPhone using Tapatalk Pro




  7. #15
    Registered User samsonact's Avatar
    Join Date
    01-05-2019
    Location
    Vancouver, WA
    Posts
    207
    Thanks
    61
    Thanked 17 Times in 14 Posts
    Images: 9

    Re: Rubber boa

    Iv'e tried googling how to find rubber boas because they live in my area but it's confusing for me. Does anyone know how to look for them or at least how to attract them to your yard?


    I live in a rural area and my yard is full of nature, so living in an urban area won't be a problem when looking for these guys. Also any tips for attracting snakes into your yard would be helpful. Thanks
    I'm T'd up
    I didn't see no speedbump
    I T'd off
    Dropped the top and screeched off

  8. #16
    Registered User samsonact's Avatar
    Join Date
    01-05-2019
    Location
    Vancouver, WA
    Posts
    207
    Thanks
    61
    Thanked 17 Times in 14 Posts
    Images: 9

    Re: Rubber boa

    wait this belongs in another forum nvm
    I'm T'd up
    I didn't see no speedbump
    I T'd off
    Dropped the top and screeched off

  9. #17
    BPnet Veteran cletus's Avatar
    Join Date
    08-26-2016
    Location
    San Antonio, TX
    Posts
    1,801
    Thanks
    1,356
    Thanked 1,343 Times in 955 Posts
    Images: 44
    I spent a lot of time in the woods and up in the mountains when I lived in Oregon and was always on the lookout for them but never saw one.

  10. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    708
    Thanks
    70
    Thanked 476 Times in 260 Posts

    Re: Rubber boa

    Quote Originally Posted by cletus View Post
    I spent a lot of time in the woods and up in the mountains when I lived in Oregon and was always on the lookout for them but never saw one.
    I rafted in prime territory for them for two decades up in Idaho and only ever found one. They are really secretive little buggers
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following User Says Thank You to asplundii For This Useful Post:

    cletus (01-07-2019)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1