Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 426

12 members and 414 guests
Most users ever online was 3,642, 05-08-2016 at 09:50 AM.


» Today's Birthdays

None

» Stats

Members: 63,383
Threads: 237,145
Posts: 2,462,502
Top Poster: JLC (31,652)
Welcome to our newest member, Zrycc
Page 1 of 2 12 LastLast
Results 1 to 10 of 18

Thread: Rubber boa

  1. #1
    Registered User midgard's Avatar
    Join Date
    05-19-2015
    Location
    New York
    Posts
    435
    Thanks
    101
    Thanked 133 Times in 132 Posts

    Rubber boa

    Anyone have experience with them? They are so cool.

  2. #2
    BPnet Senior Member Reinz's Avatar
    Join Date
    08-05-2013
    Location
    East TX
    Posts
    6,668
    Thanks
    3,905
    Thanked 3,597 Times in 2,574 Posts
    Images: 9
    Yeah, I'd love to see one!
    The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.

    1.2 Coastal Carpet Pythons
    Mack The Knife, 2013
    Lizzy, 2010
    Etta, 2013
    1.1 Jungle Carpet Pythons
    Esmarelda , 2014
    Sundance, 2012
    0.1 Normal BCI Boa, Butch, age?
    1.0 BCI Boa, Punch, 2005
    0.1 Normal Ball Python, Elvira, 2001
    0.1 Olive (Aussie) Python, Olivia, 2017

    Please excuse the spelling in my posts. Auto-Correct is my worst enema.

  3. #3
    Registered User DebbieDecker's Avatar
    Join Date
    01-20-2018
    Location
    Springfield, OR
    Posts
    31
    Thanks
    42
    Thanked 18 Times in 9 Posts
    Images: 10

    Re: Rubber boa

    I've lived in Oregon most of my life and have never seen a rubber boa. I'm glad they are so good at hiding, there are hawks everywhere.
    1.0 Pastel Orange Ghost (Atom)

  4. #4
    Registered User MR Snakes's Avatar
    Join Date
    11-25-2018
    Location
    Rockbound coast of Maine, USA
    Posts
    2,614
    Thanks
    1,232
    Thanked 446 Times in 358 Posts
    You mean like the toy rubber snakes???

  5. #5
    BPnet Veteran
    Join Date
    07-09-2015
    Location
    NM
    Posts
    1,381
    Thanks
    675
    Thanked 675 Times in 477 Posts
    I've seen them listed for sale exactly once...and then, they were gone.
    (They weren't cheap, either.)

  6. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    708
    Thanks
    70
    Thanked 476 Times in 260 Posts
    I have a pair. They are a fun little species, very calm and deliberate in their actions. Also dead easy to care for, just set them up at room temps and leave them alone. They can be a bit of a pain to get feeding when young but once they start they are full on gluttons. There are a few breeders out there with them if you go looking but be prepared to wait as it seems most breeders wait to sell the babies after they are a year or so old. Price on them is not that bad either, expect to pay ~$200-$400 or so
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #7
    Registered User MR Snakes's Avatar
    Join Date
    11-25-2018
    Location
    Rockbound coast of Maine, USA
    Posts
    2,614
    Thanks
    1,232
    Thanked 446 Times in 358 Posts
    Pics???

  8. #8
    BPnet Lifer zina10's Avatar
    Join Date
    08-09-2010
    Location
    southeast
    Posts
    4,556
    Thanks
    5,656
    Thanked 6,108 Times in 2,591 Posts
    Used to have 2. They were really cool. Very easy to take care of.

    One ate regularly, the other one skipped here and there. They always look much prettier in person, than they do in pictures. Back then I paid around $100 for each one or so.
    Zina

    0.1 Super Emperor Pinstripe Ball Python "Sunny"
    0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna"
    0.1 Pastel Desert Ghost Ball Python "Arjanam"
    0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora"
    0.1 Pastel Enchi Desert Ghost Ball Python "Venus"
    1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius"
    1.0 Pastel Yellowbelly Ball Python "Jag"
    1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"

    "It is only with the heart that one can see rightly; what is essential is invisible to the eye."
    - Antoine de Saint-Exup╚ry

  9. #9
    Registered User
    Join Date
    04-28-2018
    Location
    USA
    Posts
    5,272
    Thanks
    7,309
    Thanked 3,878 Times in 2,477 Posts
    They're very similar to rosy boas actually, but they're found at higher elevations in the mountains & need cooler temperatures, whereas the rosy boas
    are found in coastal & desert areas (as well as inter-grade areas in-between). They are protected (CA Fish & Game) & not many are bred in captivity.
    (I've never kept rubber boas, only rosy boas.)
    Last edited by Bogertophis; 12-03-2018 at 04:55 PM.

  10. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    708
    Thanks
    70
    Thanked 476 Times in 260 Posts

    Re: Rubber boa

    Quote Originally Posted by MR Snakes View Post
    Pics???
    Ever since PhotoBucket went to Hades in a hand basket I kind of gave up on finding a photohosting site. If you have Instagram you can see some pics of them there... @actcattgg
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1