Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 925

10 members and 915 guests
Most users ever online was 4,261, 10-01-2019 at 06:44 PM.


» Today's Birthdays

» Stats

Members: 65,844
Threads: 240,551
Posts: 2,499,270
Top Poster: JLC (31,651)
Welcome to our newest member, jaymims
Results 1 to 9 of 9
  1. #1
    Registered User
    Join Date
    10-13-2016
    Location
    VT
    Posts
    196
    Thanks
    122
    Thanked 170 Times in 84 Posts

    Possible impact of pattern variation?

    Has anyone bred a black pastel like this? If so, do you have pictures you can share? Just wondering how this style of pattern potentially impacts outcomes. Thanks!

  2. The Following 2 Users Say Thank You to Tila For This Useful Post:

    spellbound04 (07-03-2017),the_rotten1 (07-04-2017)

  3. #2
    Registered User
    Join Date
    01-19-2017
    Posts
    206
    Thanks
    415
    Thanked 79 Times in 65 Posts

    Re: Possible impact of pattern variation?

    I have no idea but he's stunning

    1.0 Normal
    Normal doesn't mean boring! 😊

  4. The Following User Says Thank You to spellbound04 For This Useful Post:

    Tila (07-03-2017)

  5. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    800
    Thanks
    83
    Thanked 561 Times in 311 Posts
    Fused alien heads are not uncommon in BlkPastel
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    PitOnTheProwl (07-03-2017)

  7. #4
    Registered User
    Join Date
    10-13-2016
    Location
    VT
    Posts
    196
    Thanks
    122
    Thanked 170 Times in 84 Posts
    I am aware that fused alien heads are common. My question is what influence the more fused pattern style may have on a morph combination that already does that sort of thing, such as a black pastel mojave. I have read that only certain aspects of morphs are directly heritable and the rest appears due to chance but I was hoping someone with a similar appearing snake might have bred theirs and would be willing to share the outcome. I enjoy using the morph calculator but it is limited. It would be cool if they added a feature where you could choose things like "reduced pattern x" or "high expression x" to try out in pairings.

  8. #5
    Registered User
    Join Date
    10-13-2016
    Location
    VT
    Posts
    196
    Thanks
    122
    Thanked 170 Times in 84 Posts

    Smile

    Tgatcccgtcactataggatcgtaactaccatgtccgtttaattggagtactg. By the way, asplundii, I complemented your footnote. Forgive me, it was pretty base.

  9. #6
    BPnet Lifer wolfy-hound's Avatar
    Join Date
    10-10-2005
    Location
    Florida
    Posts
    5,505
    Thanks
    2,127
    Thanked 2,219 Times in 1,151 Posts
    Images: 23
    It somewhat resembles my cinnamon line and the 'smeared' patterning seemed to breed true in cinnamon offspring but I have not produced a combo to compare the patterns yet. I would expect in some snakes the patterns will breed true and in others it will not. Like all genetic traits, you would still need to breed it out to prove whether it will or will not show true.

    Most morphs are basically just a genetic pattern that breeds true after all.
    Theresa Baker
    No Legs and More
    Florida, USA
    "Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "

  10. The Following User Says Thank You to wolfy-hound For This Useful Post:

    Tila (07-03-2017)

  11. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    800
    Thanks
    83
    Thanked 561 Times in 311 Posts
    Quote Originally Posted by Tila View Post
    I am aware that fused alien heads are common. My question is what influence the more fused pattern style may have on a morph combination that already does that sort of thing, such as a black pastel mojave. I have read that only certain aspects of morphs are directly heritable and the rest appears due to chance but I was hoping someone with a similar appearing snake might have bred theirs and would be willing to share the outcome. I enjoy using the morph calculator but it is limited. It would be cool if they added a feature where you could choose things like "reduced pattern x" or "high expression x" to try out in pairings.
    While it all comes down to genetics of some sort, it is a matter of do the right random combination of genes that, in combination, affect the outcome to give you the phenotype you are looking for. With SuperBlk complex animals, the het BluEl genes and the Pied allele seem to push toward a greater occurrence of fused alien heads. Flip side, fused alien heads does not necessarily mean that there is a het BluEL or a Pied allele in the mix, it could just be some random other gene(s) interacting with the SuperBlk gene. Now, you could certainly selectively breed to maintain that phenotype, enriching for the presence of the other random gene(s), but once outside of your collection there is no guarantee the phenotype will be perpetuated because others might not maintain the level of selective breeding you would have.


    Quote Originally Posted by Tila View Post
    Tgatcccgtcactataggatcgtaactaccatgtccgtttaattggagtactg. By the way, asplundii, I complemented your footnote. Forgive me, it was pretty base.
    Not sure what you were trying to say… I translated your sequence (in all three frames) and I did not come up with any coherent “words”. And a BLAST was equally uninformative…
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. The Following User Says Thank You to asplundii For This Useful Post:

    Tila (07-05-2017)

  13. #8
    Registered User
    Join Date
    10-13-2016
    Location
    VT
    Posts
    196
    Thanks
    122
    Thanked 170 Times in 84 Posts

    Re: Possible impact of pattern variation?

    Thanks for the info. That was really helpful,
    that's what I was wondering about.
    Quote Originally Posted by asplundii View Post
    Not sure what you were trying to say… I translated your sequence (in all three frames) and I did not come up with any coherent “whoops, I deleted something important here I don't know how to fix”. And a BLAST was equally uninformative…
    I thought the letters stood for the 4 nitrogenous bases found in DNA, guanine, adenine, thymine and cytosine. I thought you represented a sequence of nucleobases (probably non-coding) so I mirrored them (t pairs with a, g pairs with c) hence the science-themed puns of "complement" and "base." Epic science joke fail, in short.

  14. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    800
    Thanks
    83
    Thanked 561 Times in 311 Posts

    Re: Possible impact of pattern variation?

    Quote Originally Posted by Tila View Post
    Thanks for the info. That was really helpful,
    that's what I was wondering about.e
    No worries


    Quote Originally Posted by Tila View Post
    I thought the letters stood for the 4 nitrogenous bases found in DNA, guanine, adenine, thymine and cytosine. I thought you represented a sequence of nucleobases (probably non-coding) so I mirrored them (t pairs with a, g pairs with c) hence the science-themed puns of "complement" and "base." Epic science joke fail, in short.
    Okay, I see now. Yes, my sig is a nucleotide sequence but it is not a naturally occurring one (at least not so far). I assumed you had translated the sequence and then had replied in the same manner... I totally missed that you had simply generated the complementary strand LOL. So fail on my end as well
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1